Haplogroup I-M253

• 1. Defining Genetic Markers

  ›

  The genetic identity of Haplogroup I-M253 rests on a specific set of single nucleotide polymorphisms. These markers include M253, M307.2/P203.2, and M450/S109 among others. A 2017 ISOGG report lists over thirty distinct mutations that define this lineage. Peter Underhill of Stanford University identified the primary marker M253. Michael Hammer from the University of Arizona contributed to defining P30. James F. Wilson at the University of Edinburgh helped establish P40. Each mutation represents a change in the DNA sequence at a precise location on chromosome Y. The C to T transition occurs at position ChrY:13532101 for the M253 marker. The G to A shift defines the P30 variant found in many carriers today.

  1419

• 2. Origins And Ancient History

  ›

  Haplogroup I1 first appeared among Upper Paleolithic European hunter-gatherers as a minor lineage. It remained rare until the Nordic Bronze Age triggered its rapid expansion. Only six ancient DNA samples dated before the Nordic Bronze Age have been assigned to haplogroup I1. Sample SF11 comes from a Scandinavian hunter-gatherer buried on Stora Karlsö around 7500 BC. This individual carried nine of the 312 SNPs that define modern I1. Another sample BAB5 dates between 5600 and 4900 BC but lacks radiocarbon dating confirmation. Oll009 is an early Bronze Age man from Southern Sweden who lived between 1930 and 1750 BC. He possessed high Western Steppe-Herder ancestry similar to Battle Axe culture populations. Most living men with I1 share a common ancestor born between 2500 and 2400 BCE. This suggests a founder effect occurred during the Nordic Bronze Age rather than earlier periods.

  232830

• 3. Migration Patterns And Expansion

  ›

  Germanic tribes began moving out of southern Scandinavia and northern Germany around 900 BC. They migrated into lands between the Elbe and Oder rivers. A second wave crossed the Baltic Sea between 600 and 300 BC to settle alongside the Vistula river. The Wielbark culture formed in this region and is associated with the Goths. Polish researchers assigned Y-DNA haplogroups to sixteen individuals at the Kowalewko burial site in 2017. Eight of these belonged to haplogroup I1, including three specific subclades like I-L1237. Anglo-Saxon settlers introduced I1 to the British Isles starting in the Migration Period. A 2022 study found that roughly 34.17% of samples from Anglo-Saxon period England carried haplogroup I1. Norwegian and Danish Vikings brought more I1 to Britain and Ireland during the Viking Age. Swedish Vikings introduced it to Russia and Ukraine while also increasing its presence in Finland and Estonia. Margaryan et al analyzed 442 Viking world individuals in 2020 and found I-M253 was the most common Y-haplogroup.

  555672

• 4. Modern Geographical Distribution

  ›

  Haplogroup I-M253 reaches peak frequencies in Sweden where 52 percent of males in Västra Götaland County carry it. Western Finland shows over 50 percent prevalence in Satakunta province. National averages show 38-39% of Swedish males possess this lineage. Norway records 37% while Denmark sits at 34.8%. Iceland has about 34.5% and Finland around 28%. Immigrant nations like the United States and Australia host significant populations due to historical migration. Albanians in Tirana show only 3.6% frequency according to Battaglia et al 2008. Austria displays just 2.3% in a sample of 43 men. The Weale paper from 2002 highlighted genetic differences between English and Welsh populations. England showed markedly higher levels than Wales suggesting Anglo-Saxon mass invasion. Christian Capelli's 2003 study modified these conclusions by finding a gradual decrease moving westwards across southern Great Britain. Norwegian Vikings heavily influenced northern areas while both English and Scottish samples retained German-Danish influence.

  681240

• 5. Notable Historical Figures

  ›

  Alexander Hamilton, founding father of the United States, tested positive for Haplogroup I-M253. Birger Jarl, Duke of Sweden and founder of Stockholm, was exhumed and tested in 2002 confirming his status as an I-M253 carrier. His House of Bjälbo provided three kings of Norway and one king of Denmark in the 14th century. British musician Gordon Sumner known professionally as Sting belongs to this lineage. William Bradford governed the Plymouth Colony and carried this Y-chromosome type. Confederate general Robert E. Lee also falls within this group along with other prominent members of the Lee family of Virginia. Ludwig van Beethoven the German composer is another confirmed member. Leo Tolstoy the Russian writer shares this ancestry. Andrew Jackson served as President of the United States under this haplogroup. Swedish Sámi Ice hockey player Börje Salming carries the marker. American actor Chris Pine belongs to subclade I1-A13819. Felix Kjellberg known online as PewDiePie is a Swedish YouTuber who tests positive for I1-L22.

  669974

• 6. Scientific Methodology And Data

  ›

  Laboratories use specific primers to identify mutations on chromosome Y. Forward primer GCAACAATGAGGGTTTTTTTG targets the M253 region. Reverse primer CAGCTCCACCTCTATGCAGTTT completes the amplification process. The mutation involves a nucleotide change from C to T at base pair position 283. Michael Hammer and James F. Wilson developed techniques to detect P30 and P40 variants. Their work established that P30 changes G to A while P40 shifts C to T. Researchers analyze samples like SF11 which carried nine of thirty-one SNPs defining haplogroup I1. Ancient DNA studies compare modern sequences with remains such as Oll009 from Southern Sweden. Phylogenetic trees map relationships between different branches like I-DF29 and I-Z63. Y-Full published results in January 2022 suggesting formation around 27,500 years ago. The time to most recent common ancestor calculation places the origin near 2600 BC. Databases like YHRD store STR Haplotype Reference data for public access. The I1 YTree project maintains records of subclades including I-Y15024 and I-S2077.

  192435