Haplogroup I-M253
The genetic identity of Haplogroup I-M253 rests on a specific set of single nucleotide polymorphisms. These markers include M253, M307.2/P203.2, and M450/S109 among others. A 2017 ISOGG report lists over thirty distinct mutations that define this lineage. Peter Underhill of Stanford University identified the primary marker M253. Michael Hammer from the University of Arizona contributed to defining P30. James F. Wilson at the University of Edinburgh helped establish P40. Each mutation represents a change in the DNA sequence at a precise location on chromosome Y. The C to T transition occurs at position ChrY:13532101 for the M253 marker. The G to A shift defines the P30 variant found in many carriers today.
Haplogroup I1 first appeared among Upper Paleolithic European hunter-gatherers as a minor lineage. It remained rare until the Nordic Bronze Age triggered its rapid expansion. Only six ancient DNA samples dated before the Nordic Bronze Age have been assigned to haplogroup I1. Sample SF11 comes from a Scandinavian hunter-gatherer buried on Stora Karlsö around 7500 BC. This individual carried nine of the 312 SNPs that define modern I1. Another sample BAB5 dates between 5600 and 4900 BC but lacks radiocarbon dating confirmation. Oll009 is an early Bronze Age man from Southern Sweden who lived between 1930 and 1750 BC. He possessed high Western Steppe-Herder ancestry similar to Battle Axe culture populations. Most living men with I1 share a common ancestor born between 2500 and 2400 BCE. This suggests a founder effect occurred during the Nordic Bronze Age rather than earlier periods.
Germanic tribes began moving out of southern Scandinavia and northern Germany around 900 BC. They migrated into lands between the Elbe and Oder rivers. A second wave crossed the Baltic Sea between 600 and 300 BC to settle alongside the Vistula river. The Wielbark culture formed in this region and is associated with the Goths. Polish researchers assigned Y-DNA haplogroups to sixteen individuals at the Kowalewko burial site in 2017. Eight of these belonged to haplogroup I1, including three specific subclades like I-L1237. Anglo-Saxon settlers introduced I1 to the British Isles starting in the Migration Period. A 2022 study found that roughly 34.17% of samples from Anglo-Saxon period England carried haplogroup I1. Norwegian and Danish Vikings brought more I1 to Britain and Ireland during the Viking Age. Swedish Vikings introduced it to Russia and Ukraine while also increasing its presence in Finland and Estonia. Margaryan et al analyzed 442 Viking world individuals in 2020 and found I-M253 was the most common Y-haplogroup.
Haplogroup I-M253 reaches peak frequencies in Sweden where 52 percent of males in Västra Götaland County carry it. Western Finland shows over 50 percent prevalence in Satakunta province. National averages show 38-39% of Swedish males possess this lineage. Norway records 37% while Denmark sits at 34.8%. Iceland has about 34.5% and Finland around 28%. Immigrant nations like the United States and Australia host significant populations due to historical migration. Albanians in Tirana show only 3.6% frequency according to Battaglia et al 2008. Austria displays just 2.3% in a sample of 43 men. The Weale paper from 2002 highlighted genetic differences between English and Welsh populations. England showed markedly higher levels than Wales suggesting Anglo-Saxon mass invasion. Christian Capelli's 2003 study modified these conclusions by finding a gradual decrease moving westwards across southern Great Britain. Norwegian Vikings heavily influenced northern areas while both English and Scottish samples retained German-Danish influence.
Alexander Hamilton, founding father of the United States, tested positive for Haplogroup I-M253. Birger Jarl, Duke of Sweden and founder of Stockholm, was exhumed and tested in 2002 confirming his status as an I-M253 carrier. His House of Bjälbo provided three kings of Norway and one king of Denmark in the 14th century. British musician Gordon Sumner known professionally as Sting belongs to this lineage. William Bradford governed the Plymouth Colony and carried this Y-chromosome type. Confederate general Robert E. Lee also falls within this group along with other prominent members of the Lee family of Virginia. Ludwig van Beethoven the German composer is another confirmed member. Leo Tolstoy the Russian writer shares this ancestry. Andrew Jackson served as President of the United States under this haplogroup. Swedish Sámi Ice hockey player Börje Salming carries the marker. American actor Chris Pine belongs to subclade I1-A13819. Felix Kjellberg known online as PewDiePie is a Swedish YouTuber who tests positive for I1-L22.
Laboratories use specific primers to identify mutations on chromosome Y. Forward primer GCAACAATGAGGGTTTTTTTG targets the M253 region. Reverse primer CAGCTCCACCTCTATGCAGTTT completes the amplification process. The mutation involves a nucleotide change from C to T at base pair position 283. Michael Hammer and James F. Wilson developed techniques to detect P30 and P40 variants. Their work established that P30 changes G to A while P40 shifts C to T. Researchers analyze samples like SF11 which carried nine of thirty-one SNPs defining haplogroup I1. Ancient DNA studies compare modern sequences with remains such as Oll009 from Southern Sweden. Phylogenetic trees map relationships between different branches like I-DF29 and I-Z63. Y-Full published results in January 2022 suggesting formation around 27,500 years ago. The time to most recent common ancestor calculation places the origin near 2600 BC. Databases like YHRD store STR Haplotype Reference data for public access. The I1 YTree project maintains records of subclades including I-Y15024 and I-S2077.
Common questions
What specific genetic markers define Haplogroup I-M253?
Haplogroup I-M253 is defined by single nucleotide polymorphisms including M253, M307.2/P203.2, and M450/S109. A 2017 ISOGG report lists over thirty distinct mutations that characterize this lineage.
When did Haplogroup I1 first appear in human history?
Haplogroup I1 first appeared among Upper Paleolithic European hunter-gatherers as a minor lineage before the Nordic Bronze Age. The time to most recent common ancestor calculation places the origin near 2600 BC according to Y-Full results published in January 2022.
Which historical figures tested positive for Haplogroup I-M253?
Alexander Hamilton, Andrew Jackson, Ludwig van Beethoven, Leo Tolstoy, Robert E. Lee, William Bradford, Birger Jarl, Sting, Chris Pine, and PewDiePie all carry Haplogroup I-M253. Birger Jarl was exhumed and tested in 2002 confirming his status as an I-M253 carrier.
Where does Haplogroup I-M253 reach its highest population frequencies today?
Haplogroup I-M253 reaches peak frequencies in Sweden where 52 percent of males in Västra Götaland County carry it. Western Finland shows over 50 percent prevalence in Satakunta province while Norway records 37% and Denmark sits at 34.8%.
How did Germanic tribes spread Haplogroup I1 across Europe?
Germanic tribes began moving out of southern Scandinavia and northern Germany around 900 BC into lands between the Elbe and Oder rivers. A second wave crossed the Baltic Sea between 600 and 300 BC to settle alongside the Vistula river forming the Wielbark culture associated with the Goths.
All sources
102 references cited across the entry
- 1journalPhylogeography of Y-chromosome haplogroup I reveals distinct domains of prehistoric gene flow in europeRootsi S, Magri C, Kivisild T, Benuzzi G, Help H, Bermisheva M, Kutuev I, Barać L, Pericić M, Balanovsky O, Pshenichnov A, Dion D, Grobei M, Zhivotovsky LA, Battaglia V, Achilli A, Al-Zahery N, Parik J, King R, Cinnioğlu C, Khusnutdinova E, Rudan P, Balanovska E, Scheffrahn W, Simonescu M, Brehm A, Goncalves R, Rosa A, Moisan JP, Chaventre A, Ferak V, Füredi S, Oefner PJ, Shen P, Beckman L, Mikerezi I, Terzić R, Primorac D, Cambon-Thomsen A, Krumina A, Torroni A, Underhill PA, Santachiara-Benerecetti AS, Villems R, Semino O — July 2004
- 2bookRethinking the Human Revolution.Underhill PA, Myres NM, Rootsi S, Chow CT, Lin AA, Otillar RP, King R, Zhivotovsky LA, Balanovsky O, Pshenichnov A, Ritchie KH — McDonald Institute Monographs — 2007
- 3journalMigration Waves to the Baltic Sea RegionT. Lappalainen et al. — 2008
- 5journalMigration waves to the Baltic Sea regionLappalainen T, Laitinen V, Salmela E, Andersen P, Huoponen K, Savontaus ML, Lahermo P — May 2008
- 6journalPopulation structure in contemporary Sweden—a Y-chromosomal and mitochondrial DNA analysisLappalainen T, Hannelius U, Salmela E, von Döbeln U, Lindgren CM, Huoponen K, Savontaus ML, Kere J, Lahermo P — January 2009
- 8journalGeographical heterogeneity of Y-chromosomal lineages in NorwayDupuy BM, Stenersen M, Lu TT, Olaisen B — December 2006
- 10webY-DNA Haplogrupper
- 11journalY chromosome SNP haplogroups in Danes, Greenlanders and SomalisSanchez JJ — 2004
- 13journalEstimating Scandinavian and Gaelic ancestry in the male settlers of IcelandHelgason A, Sigureth ardóttir S, Nicholson J, Sykes B, Hill EW, Bradley DG, Bosnes V, Gulcher JR, Ward R, Stefánsson K — September 2000
- 14webThe Greater Nordic Regional Y-DNA ProjectApril 2021
- 15journalAncient genomes from Iceland reveal the making of a human populationEbenesersdóttir SS, Sandoval-Velasco M, Gunnarsdóttir ED, Jagadeesan A, Guðmundsdóttir VB, Thordardóttir EL, Einarsdóttir MS, Moore KH, Sigurðsson Á, Magnúsdóttir DN, Jónsson H, Snorradóttir S, Hovig E, Møller P, Kockum I, Olsson T, Alfredsson L, Hansen TF, Werge T, Cavalleri GL, Gilbert E, Lalueza-Fox C, Walser JW, Kristjánsdóttir S, Gopalakrishnan S, Árnadóttir L, Magnússon ÓÞ, Gilbert MT, Stefánsson K, Helgason A — June 2018
- 16journalRegional differences among the Finns: a Y-chromosomal perspectiveLappalainen T, Koivumäki S, Salmela E, Huoponen K, Sistonen P, Savontaus ML, Lahermo P — July 2006
- 18webI1 YTreeYfull.com — 2022-04-06
- 19journalNew binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup treeKarafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF — May 2008
- 20journalLarge-scale recent expansion of European patrilineages shown by population resequencingBatini C, Hallast P, Zadik D, Delser PM, Benazzo A, Ghirotto S, Arroyo-Pardo E, Cavalleri GL, de Knijff P, Dupuy BM, Eriksen HA, King TE, de Munain AL, López-Parra AM, Loutradis A, Milasin J, Novelletto A, Pamjav H, Sajantila A, Tolun A, Winney B, Jobling MA — May 2015
- 22webI-DF29 YTree
- 23journalThe genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizonMalmström H, Günther T, Svensson EM, Juras A, Fraser M, Munters AR, Pospieszny Ł, Tõrv M, Lindström J, Götherström A, Storå J, Jakobsson M — October 2019
- 24webI-Y11204 YTree
- 25journal100 ancient genomes show repeated population turnovers in Neolithic DenmarkMorten E. Allentoft et al. — January 2024
- 27journalPopulation genomics of Mesolithic Scandinavia: Investigating early postglacial migration routes and high-latitude adaptationTorsten Günther et al. — 2018
- 28webHaplotree.info sample: SF11SF11 – Stora Förvar, Stora Karlsö I-Z2699*
- 29journalGenomic diversity and admixture differs for Stone-Age Scandinavian foragers and farmersSkoglund P, Malmström H, Omrak A, Raghavan M, Valdiosera C, Günther T, Hall P, Tambets K, Parik J, Sjögren KG, Apel J, Willerslev E, Storå J, Götherström A, Jakobsson M — May 2014
- 30webfamilytreedna.com I-Z2699 treeApril 2021
- 31journalTracing the genetic origin of Europe's first farmers reveals insights into their social organizationSzécsényi-Nagy A, Brandt G, Haak W, Keerl V, Jakucs J, Möller-Rieker S, Köhler K, Mende BG, Oross K, Marton T, Osztás A, Kiss V, Fecher M, Pálfi G, Molnár E, Sebők K, Czene A, Paluch T, Šlaus M, Novak M, Pećina-Šlaus N, Ősz B, Voicsek V, Somogyi K, Tóth G, Kromer B, Bánffy E, Alt KW — April 2015
- 32webBAB5 I-Z2699*
- 33journalFine-scale sampling uncovers the complexity of migrations in 5th-6th century PannoniaDeven N. Vyas et al. — 2023-09-25
- 34journalPopulation genomics of Bronze Age EurasiaAllentoft ME, Sikora M, Sjögren KG, Rasmussen S, Rasmussen M, Stenderup J, Damgaard PB, Schroeder H, Ahlström T, Vinner L, Malaspinas AS, Margaryan A, Higham T, Chivall D, Lynnerup N, Harvig L, Baron J, Della Casa P, Dąbrowski P, Duffy PR, Ebel AV, Epimakhov A, Frei K, Furmanek M, Gralak T, Gromov A, Gronkiewicz S, Grupe G, Hajdu T, Jarysz R, Khartanovich V, Khokhlov A, Kiss V, Kolář J, Kriiska A, Lasak I, Longhi C, McGlynn G, Merkevicius A, Merkyte I, Metspalu M, Mkrtchyan R, Moiseyev V, Paja L, Pálfi G, Pokutta D, Pospieszny Ł, Price TD, Saag L, Sablin M, Shishlina N, Smrčka V, Soenov VI, Szeverényi V, Tóth G, Trifanova SV, Varul L, Vicze M, Yepiskoposyan L, Zhitenev V, Orlando L, Sicheritz-Pontén T, Brunak S, Nielsen R, Kristiansen K, Willerslev E — June 2015
- 36journalThe genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizonMalmstrom H — July 2019
- 38journalMegalithic tombs in western and northern Neolithic Europe were linked to a kindred societySánchez-Quinto F, Malmström H, Fraser M, Girdland-Flink L, Svensson EM, Simões LG, George R, Hollfelder N, Burenhult G, Noble G, Britton K, Talamo S, Curtis N, Brzobohata H, Sumberova R, Götherström A, Storå J, Jakobsson M — May 2019
- 39journalAncient mitochondrial DNA from the northern fringe of the Neolithic farming expansion in Europe sheds light on the dispersion processMalmström H, Linderholm A, Skoglund P, Storå J, Sjödin P, Gilbert MT, Holmlund G, Willerslev E, Jakobsson M, Lidén K, Götherström A — January 2015
- 40journalY-chromosome diversity in Sweden – a long-time perspectiveKarlsson AO, Wallerström T, Götherström A, Holmlund G — August 2006
- 42journalPunctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequencesPoznik GD, Xue Y, Mendez FL, Willems TF, Massaia A, Wilson Sayres MA, Ayub Q, McCarthy SA, Narechania A, Kashin S, Chen Y, Banerjee R, Rodriguez-Flores JL, Cerezo M, Shao H, Gymrek M, Malhotra A, Louzada S, Desalle R, Ritchie GR, Cerveira E, Fitzgerald TW, Garrison E, Marcketta A, Mittelman D, Romanovitch M, Zhang C, Zheng-Bradley X, Abecasis GR, McCarroll SA, Flicek P, Underhill PA, Coin L, Zerbino DR, Yang F, Lee C, Clarke L, Auton A, Erlich Y, Handsaker RE, Bustamante CD, Tyler-Smith C — June 2016
- 43journalHolocene Selection for Variants Associated with General Cognitive Ability: Comparing Ancient and Modern GenomesWoodley M — February 2017
- 44journalThe Celts and the Ethnogenesis of the Germanic PeopleSchmidt KH — 1991
- 45journalBronze Age Identities: Costume, Conflict and Contact in Northern Europe 1600–1300 BCBergerbrant S — May 2007
- 46journalConnection between Wielkopolska and the Baltic Sea Region in the Roman IronTeska M, Michalowski A — 2014
- 47conferenceY-Chromosome Haplogroup Assignment Through Next Generation Sequencing of Enriched Ancient DNA LibrariesZenczak M, Handschuh L, Juras A, Marcinkowska-Swojak M, Philips A, Piontek J, Stolarek I, Figlerowicz M — 2017
- 48journalUnderstanding 6th-century barbarian social organization and migration through paleogenomicsAmorim CE, Vai S, Posth C, Modi A, Koncz I, Hakenbeck S, La Rocca MC, Mende B, Bobo D, Pohl W, Baricco LP, Bedini E, Francalacci P, Giostra C, Vida T, Winger D, von Freeden U, Ghirotto S, Lari M, Barbujani G, Krause J, Caramelli D, Geary PJ, Veeramah KR — September 2018
- 49webLongobards Ancient DNA from Pannonia and Italy – What Does Their DNA Tell Us? Are You Related?Estes R — 2020-10-16
- 50journalGender distribution of excavation finds from the Roman imperial and migration periodLabudde D — July 2015
- 51journalAncient Rome: A genetic crossroads of Europe and the MediterraneanAntonio ML, Gao Z, Moots HM, Lucci M, Candilio F, Sawyer S, Oberreiter V, Calderon D, Devitofranceschi K, Aikens RC, Aneli S, Bartoli F, Bedini A, Cheronet O, Cotter DJ, Fernandes DM, Gasperetti G, Grifoni R, Guidi A, La Pastina F, Loreti E, Manacorda D, Matullo G, Morretta S, Nava A, Fiocchi Nicolai V, Nomi F, Pavolini C, Pentiricci M, Pergola P, Piranomonte M, Schmidt R, Spinola G, Sperduti A, Rubini M, Bondioli L, Coppa A, Pinhasi R, Pritchard JK — November 2019
- 52journalThe genomic history of the Iberian Peninsula over the past 8000 yearsOlalde I, Mallick S, Patterson N, Rohland N, Villalba-Mouco V, Silva M, Dulias K, Edwards CJ, Gandini F, Pala M, Soares P, Ferrando-Bernal M, Adamski N, Broomandkhoshbacht N, Cheronet O, Culleton BJ, Fernandes D, Lawson AM, Mah M, Oppenheimer J, Stewardson K, Zhang Z, Jiménez Arenas JM, Toro Moyano IJ, Salazar-García DC, Castanyer P, Santos M, Tremoleda J, Lozano M, García Borja P, Fernández-Eraso J, Mujika-Alustiza JA, Barroso C, Bermúdez FJ, Viguera Mínguez E, Burch J, Coromina N, Vivó D, Cebrià A, Fullola JM, García-Puchol O, Morales JI, Oms FX, Majó T, Vergès JM, Díaz-Carvajal A, Ollich-Castanyer I, López-Cachero FJ, Silva AM, Alonso-Fernández C, Delibes de Castro G, Jiménez Echevarría J, Moreno-Márquez A, Pascual Berlanga G, Ramos-García P, Ramos-Muñoz J, Vijande Vila E, Aguilella Arzo G, Esparza Arroyo Á, Lillios KT, Mack J, Velasco-Vázquez J, Waterman A, Benítez de Lugo Enrich L, Benito Sánchez M, Agustí B, Codina F, de Prado G, Estalrrich A, Fernández Flores Á, Finlayson C, Finlayson G, Finlayson S, Giles-Guzmán F, Rosas A, Barciela González V, García Atiénzar G, Hernández Pérez MS, Llanos A, Carrión Marco Y, Collado Beneyto I, López-Serrano D, Sanz Tormo M, Valera AC, Blasco C, Liesau C, Ríos P, Daura J, de Pedro Michó MJ, Diez-Castillo AA, Flores Fernández R, Francès Farré J, Garrido-Pena R, Gonçalves VS, Guerra-Doce E, Herrero-Corral AM, Juan-Cabanilles J, López-Reyes D, McClure SB, Merino Pérez M, Oliver Foix A, Sanz Borràs M, Sousa AC, Vidal Encinas JM, Kennett DJ, Richards MB, Werner Alt K, Haak W, Pinhasi R, Lalueza-Fox C, Reich D — March 2019
- 53journalGenomic signals of migration and continuity in Britain before the Anglo-SaxonsMartiniano R, Caffell A, Holst M, Hunter-Mann K, Montgomery J, Müldner G, McLaughlin RL, Teasdale MD, van Rheenen W, Veldink JH, van den Berg LH, Hardiman O, Carroll M, Roskams S, Oxley J, Morgan C, Thomas MG, Barnes I, McDonnell C, Collins MJ, Bradley DG — January 2016
- 54journalThe Anglo-Saxon migration and the formation of the early English gene poolJoscha Gretzinger et al. — October 2022
- 55journalPopulation genomics of the Viking worldMargaryan A, Lawson DJ, Sikora M, Racimo F, Rasmussen S, Moltke I, Cassidy LM, Jørsboe E, Ingason A, Pedersen MW, Korneliussen T, Wilhelmson H, Buś MM, de Barros Damgaard P, Martiniano R, Renaud G, Bhérer C, Moreno-Mayar JV, Fotakis AK, Allen M, Allmäe R, Molak M, Cappellini E, Scorrano G, McColl H, Buzhilova A, Fox A, Albrechtsen A, Schütz B, Skar B, Arcini C, Falys C, Jonson CH, Błaszczyk D, Pezhemsky D, Turner-Walker G, Gestsdóttir H, Lundstrøm I, Gustin I, Mainland I, Potekhina I, Muntoni IM, Cheng J, Stenderup J, Ma J, Gibson J, Peets J, Gustafsson J, Iversen KH, Simpson L, Strand L, Loe L, Sikora M, Florek M, Vretemark M, Redknap M, Bajka M, Pushkina T, Søvsø M, Grigoreva N, Christensen T, Kastholm O, Uldum O, Favia P, Holck P, Sten S, Arge SV, Ellingvåg S, Moiseyev V, Bogdanowicz W, Magnusson Y, Orlando L, Pentz P, Jessen MD, Pedersen A, Collard M, Bradley DG, Jørkov ML, Arneborg J, Lynnerup N, Price N, Gilbert MT, Allentoft ME, Bill J, Sindbæk SM, Hedeager L, Kristiansen K, Nielsen R, Werge T, Willerslev E — September 2020
- 56journalY chromosome evidence for Anglo-Saxon mass migrationWeale ME, Weiss DA, Jager RF, Bradman N, Thomas MG — July 2002
- 57journalA Y chromosome census of the British IslesCapelli C, Redhead N, Abernethy JK, Gratrix F, Wilson JF, Moen T, Hervig T, Richards M, Stumpf MP, Underhill PA, Bradshaw P, Shaha A, Thomas MG, Bradman N, Goldstein DB — May 2003
- 58webFounding Father DNA
- 60webFaderslinjen, DNA
- 64journalPopulation genomics of the Viking worldMargaryan A, Lawson DJ, Sikora M, Racimo F, Rasmussen S, Moltke I, Cassidy LM, Jørsboe E, Ingason A, Pedersen MW, Korneliussen T, Wilhelmson H, Buś MM, de Barros Damgaard P, Martiniano R, Renaud G, Bhérer C, Moreno-Mayar JV, Fotakis AK, Allen M, Allmäe R, Molak M, Cappellini E, Scorrano G, McColl H, Buzhilova A, Fox A, Albrechtsen A, Schütz B, Skar B, Arcini C, Falys C, Jonson CH, Błaszczyk D, Pezhemsky D, Turner-Walker G, Gestsdóttir H, Lundstrøm I, Gustin I, Mainland I, Potekhina I, Muntoni IM, Cheng J, Stenderup J, Ma J, Gibson J, Peets J, Gustafsson J, Iversen KH, Simpson L, Strand L, Loe L, Sikora M, Florek M, Vretemark M, Redknap M, Bajka M, Pushkina T, Søvsø M, Grigoreva N, Christensen T, Kastholm O, Uldum O, Favia P, Holck P, Sten S, Arge SV, Ellingvåg S, Moiseyev V, Bogdanowicz W, Magnusson Y, Orlando L, Pentz P, Jessen MD, Pedersen A, Collard M, Bradley DG, Jørkov ML, Arneborg J, Lynnerup N, Price N, Gilbert MT, Allentoft ME, Bill J, Sindbæk SM, Hedeager L, Kristiansen K, Nielsen R, Werge T, Willerslev E — September 2020
- 65bookViking Rus: Studies on the Presence of Scandinavians in Eastern EuropeDuczko W — Brill — 2004
- 66journalFinding the founder of Stockholm – a kinship study based on Y-chromosomal, autosomal and mitochondrial DNAMalmström H, Vretemark M, Tillmar A, Durling MB, Skoglund P, Gilbert MT, Willerslev E, Holmlund G, Götherström A — January 2012
- 71webJackson DNA Project11 December 2020
- 72journalOrigins and history of Haplogroup I1 (Y-DNA)Hay M — July 2020
- 73webHaplogroup I1 (Y-DNA)Maciamo E
- 75webI-BY229 YTree
- 76webSwedenborg
- 79webRolf H. Nevanlinna
- 80webI1: Rolf Nevanlinna (né Neovius)olenus — 2018-03-30
- 87webI-Y24470 YTree
- 89webI Did A DNA Test... (I Guess Im Cancelled Now)25 January 2021
- 91webAndrésen, Färnskog & Hansen family researchTovseth A — June 2018
- 97webJames Pine, Sr.
- 98newsBianca Salming om relationen med Börje: "Känner mig hemsk"Janlind F — 20 February 2021
- 99webBeethoven DNA Discovery – Find Out If You Are RelatedMercedes — 2023-03-26
- 100webReference SNP (refSNP) Cluster Report: rs9341296snpdev
- 102inlineP30
- 103inlineP40